Aganirsen

Drug Profile

Aganirsen

Alternative Names: Antisense oligonucleotide TATCCGGAGGGCTCGCCATGCTGCT; GS-101; TATCCGGAGGGCTCGCCATGCTGCT

Latest Information Update: 09 Oct 2015

$50 / €47 *
* $ price applies to USA, Canada and Latin America. € price applies to the rest of the world. Final gross prices may vary according to local VAT.

At a glance

  • Originator Gene Signal
  • Class Antisense oligonucleotides; Eye disorder therapies; Skin disorder therapies
  • Mechanism of Action Insulin receptor substrate protein inhibitors
  • Orphan Drug Status

    Orphan designation is assigned by a regulatory body to encourage companies to develop drugs for rare diseases.

    Yes - Glaucoma; Keratoplasty rejection; Central retinal vein occlusion; Retinopathy of prematurity
  • New Molecular Entity Yes
  • Available For Licensing Yes - Age-related macular degeneration; Diabetic retinopathy; Glaucoma; Keratoplasty rejection; Psoriasis; Retinopathy of prematurity; Rosacea

Highest Development Phases

  • Phase III Keratoplasty rejection
  • Phase II Central retinal vein occlusion; Psoriasis
  • Phase I Diabetic retinopathy; Glaucoma; Retinopathy of prematurity; Wet age-related macular degeneration
  • Preclinical Bladder cancer
  • No development reported Rosacea
  • Discontinued Age-related macular degeneration

Most Recent Events

  • 09 Oct 2015 No recent reports on development identified - Phase-II for Rosacea in France (Topical)
  • 15 Sep 2015 Phase-I clinical trials in Wet age-related macular degeneration in France (Parenteral) before September 2015
  • 15 Sep 2015 Preclinical trials in Bladder cancer in France (unspecified route) before September 2015
Restricted Access

Oops, it looks like you don’t have a valid subscription to this content. To gain full access to the content and functionality of the AdisInsight database try one of the following.

  • with a username/password associated to an account with a valid subscription
  • Contact your organization’s admin about adding this content to your AdisInsight subscription
  • Request a trial

If you are a subscriber to this content then contact us at AsktheExpert.AdisInsight@springer.com so we can help.

Back to top