Either you have JavaScript disabled or your browser does not support Javascript . To work properly, this page requires JavaScript to be enabled.
How to enable JavaScript in your browser?

Aganirsen - Gene Signal

Next Previous
Drug Profile

Aganirsen - Gene Signal

Alternative Names: Antisense oligonucleotide TATCCGGAGGGCTCGCCATGCTGCT; GS-101; TATCCGGAGGGCTCGCCATGCTGCT

Latest Information Update: 26 Apr 2022

Price : $50 *
  • Adis is an information provider. We do not sell or distribute actual drugs.
  • Final gross price and currency may vary according to local VAT and billing address.
  • Your purchase entitles you to full access to the information contained in our drug profile at the time of purchase.
  • A link to download a PDF version of the drug profile will be included in your email receipt.

At a glance

  • Originator Gene Signal
  • Class Antiglaucomas; Antineoplastics; Antipsoriatics; Antisense oligonucleotides; Eye disorder therapies; Skin disorder therapies
  • Mechanism of Action Insulin receptor substrate protein inhibitors
  • Orphan Drug Status

    Orphan designation is assigned by a regulatory body to encourage companies to develop drugs for rare diseases.

    Yes - Glaucoma; Keratoplasty rejection; Central retinal vein occlusion; Retinopathy of prematurity
  • New Molecular Entity Yes
  • Available For Licensing Yes - Age-related macular degeneration; Diabetic retinopathy; Glaucoma; Keratoplasty rejection; Psoriasis; Retinopathy of prematurity; Rosacea

Highest Development Phases

  • Phase III Keratoplasty rejection
  • Phase II Central retinal vein occlusion; Diabetic macular oedema; Wet age-related macular degeneration
  • Phase I Bladder cancer
  • Discontinued Age-related macular degeneration; Diabetic retinopathy; Glaucoma; Psoriasis; Retinopathy of prematurity; Rosacea

Most Recent Events

  • 26 Apr 2022 Aganirsen is still in phase-II trials for Diabetic macular oedema in France (Topical) (Gene Signal pipeline, April 2022)
  • 26 Apr 2022 Aganirsen is still in phase-II trials for Wet age-related macular degeneration in France (Topical) (Gene Signal pipeline, April 2022)
  • 03 Jan 2020 Discontinued - Phase-I for Diabetic retinopathy in France (Topical) (Gene Signal pipeline, January 2020)
Subscriber content

You need to be a logged in subscriber to view this content.

If your organization has a subscription then there are several options available to help you access AdisInsight, even while working remotely.

  • IP authentication when working within your organization’s network.
  • with username/password or try via your institution
  • Persisted access using your organization’s identifier stored in your user browser for 90 days.
  • Contact us at AsktheExpert.AdisInsight@springer.com for assistance.

If your organization does not have a subscription to this content. To gain full access to the content and functionality of the AdisInsight database try one of the following.

  • Contact your organization’s admin about adding this content to your AdisInsight subscription
  • Buy a PDF version of the profile.
  • Request a free trial
Legal
Back to top