Either you have JavaScript disabled or your browser does not support Javascript . To work properly, this page requires JavaScript to be enabled.
How to enable JavaScript in your browser?

Aganirsen - Gene Signal

X
Drug Profile

Aganirsen - Gene Signal

Alternative Names: Antisense oligonucleotide TATCCGGAGGGCTCGCCATGCTGCT; GS-101; TATCCGGAGGGCTCGCCATGCTGCT

Latest Information Update: 28 Apr 2024

Price : $50 *
  • Adis is an information provider. We do not sell or distribute actual drugs.
  • Final gross price and currency may vary according to local VAT and billing address.
  • Your purchase entitles you to full access to the information contained in our drug profile at the time of purchase.
  • A link to download a PDF version of the drug profile will be included in your email receipt.

At a glance

  • Originator Gene Signal
  • Class Antiglaucomas; Antineoplastics; Antipsoriatics; Antisense oligonucleotides; Eye disorder therapies; Skin disorder therapies
  • Mechanism of Action Insulin receptor substrate protein inhibitors
  • Orphan Drug Status

    Orphan designation is assigned by a regulatory body to encourage companies to develop drugs for rare diseases.

    Yes - Glaucoma; Keratoplasty rejection; Central retinal vein occlusion; Retinopathy of prematurity
  • New Molecular Entity Yes
  • Available For Licensing Yes - Age-related macular degeneration; Diabetic retinopathy; Glaucoma; Keratoplasty rejection; Psoriasis; Retinopathy of prematurity; Rosacea

Highest Development Phases

  • Phase III Keratoplasty rejection
  • Phase II Central retinal vein occlusion; Diabetic macular oedema; Wet age-related macular degeneration
  • No development reported Bladder cancer
  • Discontinued Age-related macular degeneration; Diabetic retinopathy; Glaucoma; Psoriasis; Retinopathy of prematurity; Rosacea

Most Recent Events

  • 28 Apr 2024 No recent reports of development identified for phase-I development in Bladder-cancer in France
  • 26 Apr 2022 Aganirsen is still in phase-II trials for Diabetic macular oedema in France (Topical) (Gene Signal pipeline, April 2022)
  • 26 Apr 2022 Aganirsen is still in phase-II trials for Wet age-related macular degeneration in France (Topical) (Gene Signal pipeline, April 2022)

You need to be a logged in or subscribed to view this content Request demo

If your organization or you do not have a subscription, try one of the following:
  • Contacting your organization’s admin about adding this content to your AdisInsight subscription
  • Buying a PDF version of any individual profile
  • Request a free trial
If your organization has a subscription, there are several access options, even while working remotely:
  • Working within your organization’s network
  • with username/password or try to via your institution
  • Persisted access using your organization’s identifier stored in your user browser for 90 days
Back to top