Either you have JavaScript disabled or your browser does not support Javascript . To work properly, this page requires JavaScript to be enabled.
How to enable JavaScript in your browser?

Aganirsen

Drug Profile

Aganirsen

Alternative Names: Antisense oligonucleotide TATCCGGAGGGCTCGCCATGCTGCT; GS-101; TATCCGGAGGGCTCGCCATGCTGCT

Latest Information Update: 28 Oct 2018

Price : $50 *
* Final gross price and currency may vary according to local VAT and billing address.
* Your purchase entitles you to full access to the information contained in our drug profile at the time of purchase. A link to download a PDF version of the drug profile will be included in your email receipt. Adis is an information provider. We do not sell or distribute the pharmaceutical compounds written about in this database.

At a glance

  • Originator Gene Signal
  • Class Antisense oligonucleotides; Eye disorder therapies; Skin disorder therapies
  • Mechanism of Action Insulin receptor substrate protein inhibitors
  • Orphan Drug Status

    Orphan designation is assigned by a regulatory body to encourage companies to develop drugs for rare diseases.

    Yes - Glaucoma; Keratoplasty rejection; Central retinal vein occlusion; Retinopathy of prematurity
  • New Molecular Entity Yes
  • Available For Licensing Yes - Age-related macular degeneration; Diabetic retinopathy; Glaucoma; Keratoplasty rejection; Psoriasis; Retinopathy of prematurity; Rosacea

Highest Development Phases

  • Phase III Keratoplasty rejection
  • Phase II Central retinal vein occlusion; Psoriasis
  • Preclinical Bladder cancer
  • No development reported Diabetic retinopathy; Glaucoma; Retinopathy of prematurity; Rosacea; Wet age-related macular degeneration
  • Discontinued Age-related macular degeneration

Most Recent Events

  • 28 Oct 2018 No recent reports of development identified for phase-I development in Wet age-related macular degeneration in France (Parenteral)
  • 04 Nov 2017 No recent reports of development identified for phase-I development in Diabetic-retinopathy in France (Parenteral)
  • 04 Nov 2017 No recent reports of development identified for phase-I development in Glaucoma in European Union (Topical, Ointment)
Restricted Access

Oops, it looks like you don’t have a valid subscription to this content. To gain full access to the content and functionality of the AdisInsight database try one of the following.

  • with a username/password associated to an account with a valid subscription
  • Contact your organization’s admin about adding this content to your AdisInsight subscription
  • Request a trial

If you are a subscriber to this content then contact us at AsktheExpert.AdisInsight@springer.com so we can help.

Back to top